| Detail of EST/Unigene BE325045 |
| Acc. | BE325045 |
| Internal Acc. | NF119E09ST1F1070 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Cytochrome P450 98A2 OS=Glycine max E-value=3e-98; Cytochrome P450 98A3 OS=Arabidopsis thaliana E-value=1e-82; Cytochrome P450 98A1 OS=Sorghum bicolor E-value=2e-74; Cytochrome P450 83A1 OS=Arabidopsis thaliana E-value=2e-27; Cytochrome P450 750A1 OS=Pinus taeda E-value=3e-27; |
| Length | 592 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DSTEM2; |
| Sequence | CTGTTTCTCACAATACCCCTTTCATTCATAGCCATTTTCCTCTTTTACACACTCTTCCAA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | ; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K07413 cytochrome P450, family 2, subfamily C; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07413 cytochrome P450, family 2, subfamily C; Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K07413 cytochrome P450, family 2, subfamily C; Metabolism > Lipid Metabolism > ko00591 Linoleic acid metabolism > K07413 cytochrome P450, family 2, subfamily C; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07413 cytochrome P450, family 2, subfamily C |
| EC | 1.14.-.- 1.14.14.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 818686 |
| Trichome-related Gene from Literature | N/A |