Detail of EST/Unigene BE325255 |
Acc. | BE325255 |
Internal Acc. | NF119A09ST1F1068 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glycerate dehydrogenase OS=Cucumis sativus E-value=1e-58; Glyoxylate reductase OS=Thermococcus litoralis E-value=3e-17; Glyoxylate reductase OS=Korarchaeum cryptofilum (strain OPF8) E-value=5e-17; Glyoxylate reductase OS=Thermococcus onnurineus (strain NA1) E-value=7e-16; Glyoxylate reductase OS=Pyrococcus kodakaraensis (strain ATCC BAA-918 / JCM 12380 / KOD1) E-value=4e-15; |
Length | 435 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSTEM2; |
Sequence | CATTGCTTTGATTGGTGATAAGTGTGATGGAGTTATTGGACAGTTGACTGAAGACTGGGG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00630 Glyoxylate and dicarboxylate metabolism > K00049 glyoxylate reductase (NADP+); Metabolism > Carbohydrate Metabolism > ko00620 Pyruvate metabolism > K00049 glyoxylate reductase (NADP+); Metabolism > Amino Acid Metabolism > ko00260 Glycine, serine and threonine metabolism > K00058 D-3-phosphoglycerate dehydrogenase |
EC | 1.1.1.79 1.1.1.95 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 843129 |
Trichome-related Gene from Literature | N/A |