| Detail of EST/Unigene BE325360 |
| Acc. | BE325360 |
| Internal Acc. | NF087B11ST1F1089 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Probable alpha-galactosidase B OS=Neosartorya fumigata (strain CEA10 / CBS 144.89 / FGSC A1163) E-value=5e-11; Probable alpha-galactosidase B OS=Aspergillus niger E-value=6e-11; Probable alpha-galactosidase B OS=Aspergillus clavatus (strain ATCC 1007 / CBS 513.65 / DSM 816 / NCTC 3887 / NRRL 1) E-value=8e-11; Probable alpha-galactosidase B OS=Talaromyces emersonii E-value=1e-10; Probable alpha-galactosidase B OS=Aspergillus niger (strain CBS 513.88 / FGSC A1513) E-value=1e-10; |
| Length | 462 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DSTEM2; |
| Sequence | GGTTTCAGAGTGTGTCATCAAGAAATTTATCTGAGAGTAACATACAGCAAGTAGGCTTGC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00052 Galactose metabolism > K01189 alpha-galactosidase; Metabolism > Lipid Metabolism > ko00561 Glycerolipid metabolism > K01189 alpha-galactosidase; Metabolism > Lipid Metabolism > ko00600 Sphingolipid metabolism > K01189 alpha-galactosidase; Metabolism > Glycan Biosynthesis and Metabolism > ko00603 Glycosphingolipid biosynthesis - globoseries > K01189 alpha-galactosidase; Metabolism > Glycan Biosynthesis and Metabolism > ko00603 Glycosphingolipid biosynthesis - globoseries > K01204 alpha-N-acetylgalactosaminidase |
| EC | 3.2.1.22 3.2.1.49 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 822242 |
| Trichome-related Gene from Literature | N/A |