Detail of EST/Unigene BE325433 |
Acc. | BE325433 |
Internal Acc. | NF088H04ST1F1032 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Alpha-1,4-glucan-protein synthase [UDP-forming] OS=Pisum sativum E-value=3e-85; UDP-arabinopyranose mutase 3 OS=Arabidopsis thaliana E-value=5e-83; Alpha-1,4-glucan-protein synthase [UDP-forming] 1 OS=Solanum tuberosum E-value=2e-80; Alpha-1,4-glucan-protein synthase [UDP-forming] 2 OS=Solanum tuberosum E-value=3e-80; Alpha-1,4-glucan-protein synthase [UDP-forming] OS=Zea mays E-value=9e-80; |
Length | 493 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSTEM2; |
Sequence | CAAAAACACTCTCATCAACAACAACAACAATGGCTTCTTCATCCAAACCAACACCACTTC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 820039 |
Trichome-related Gene from Literature | 820039 |