Detail of EST/Unigene BE325483 |
Acc. | BE325483 |
Internal Acc. | NF087G08ST1F1056 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Cysteine synthase, chloroplastic/chromoplastic OS=Spinacia oleracea E-value=4e-22; Cysteine synthase, chloroplastic/chromoplastic OS=Arabidopsis thaliana E-value=7e-22; Cysteine synthase, chloroplastic/chromoplastic OS=Capsicum annuum E-value=4e-21; Cysteine synthase, mitochondrial OS=Arabidopsis thaliana E-value=8e-21; Cysteine synthase, chloroplastic/chromoplastic OS=Solanum tuberosum E-value=2e-14; |
Length | 529 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSTEM2; |
Sequence | GGATAGTGCGTGAGCTGTGACTATTCTTTGATACCACAAATCAAAGTTTCGTCTCAACTC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 818978 |
Trichome-related Gene from Literature | 818978 |