| Detail of EST/Unigene BE325527 |
| Acc. | BE325527 |
| Internal Acc. | NF088B01ST1F1009 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Granule-bound starch synthase 1, chloroplastic/amyloplastic OS=Pisum sativum E-value=6e-19; Granule-bound starch synthase 1, chloroplastic/amyloplastic OS=Antirrhinum majus E-value=1e-07; Probable granule-bound starch synthase 1, chloroplastic/amyloplastic OS=Arabidopsis thaliana E-value=1e-06; Granule-bound starch synthase 1, chloroplastic/amyloplastic OS=Ipomoea batatas E-value=3e-06; |
| Length | 317 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DSTEM2; |
| Sequence | CTGAAGGAGAATTTGACATAATCATGGCAACTATGAGGGGTTCTTCTGTGGGTGCATGCC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 840184 |
| Trichome-related Gene from Literature | N/A |