Detail of EST/Unigene BE325607 |
Acc. | BE325607 |
Internal Acc. | NF090E04ST1F1023 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Probable glucan endo-1,3-beta-glucosidase A6 OS=Arabidopsis thaliana E-value=1e-18; Glucan endo-1,3-beta-glucosidase 13 OS=Arabidopsis thaliana E-value=6e-13; Glucan endo-1,3-beta-glucosidase OS=Pisum sativum E-value=2e-11; Glucan endo-1,3-beta-glucosidase OS=Glycine max E-value=5e-11; Lichenase OS=Nicotiana plumbaginifolia E-value=1e-10; |
Length | 591 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSTEM2; |
Sequence | CTTCTCTCATCAGCAACATTGAAAATAGAAAGTAGAAACAGAGTATCAAACACACATGAC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 819920 |
Trichome-related Gene from Literature | N/A |