| Detail of EST/Unigene BE325607 |
| Acc. | BE325607 |
| Internal Acc. | NF090E04ST1F1023 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Probable glucan endo-1,3-beta-glucosidase A6 OS=Arabidopsis thaliana E-value=1e-18; Glucan endo-1,3-beta-glucosidase 13 OS=Arabidopsis thaliana E-value=6e-13; Glucan endo-1,3-beta-glucosidase OS=Pisum sativum E-value=2e-11; Glucan endo-1,3-beta-glucosidase OS=Glycine max E-value=5e-11; Lichenase OS=Nicotiana plumbaginifolia E-value=1e-10; |
| Length | 591 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DSTEM2; |
| Sequence | CTTCTCTCATCAGCAACATTGAAAATAGAAAGTAGAAACAGAGTATCAAACACACATGAC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 819920 |
| Trichome-related Gene from Literature | N/A |