| Detail of EST/Unigene BE325733 |
| Acc. | BE325733 |
| Internal Acc. | NF059F01ST1F1013 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Ribosome biogenesis protein NSA2 homolog OS=Dictyostelium discoideum E-value=1e-30; Ribosome biogenesis protein NSA2 homolog OS=Homo sapiens E-value=3e-28; Ribosome biogenesis protein NSA2 homolog OS=Rattus norvegicus E-value=3e-28; Ribosome biogenesis protein NSA2 homolog OS=Mus musculus E-value=3e-28; Ribosome biogenesis protein NSA2 homolog OS=Bos taurus E-value=3e-28; |
| Length | 600 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DSTEM2; |
| Sequence | GCTTCTCGACAAAACTAGTTGTGACTCCGCCAGACTGCCACCGTTTAACACCAAGTGGTA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00562 Inositol phosphate metabolism > K00914 phosphatidylinositol 3-kinase; Genetic Information Processing > Folding, Sorting and Degradation > ko04140 Regulation of autophagy > K00914 phosphatidylinositol 3-kinase; Environmental Information Processing > Signal Transduction > ko04070 Phosphatidylinositol signaling system > K00914 phosphatidylinositol 3-kinase |
| EC | 2.7.1.137 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 830524 |
| Trichome-related Gene from Literature | N/A |