| Detail of EST/Unigene BE325844 |
| Acc. | BE325844 |
| Internal Acc. | NF086C07ST1F1051 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Alpha-1,4-glucan-protein synthase [UDP-forming] OS=Pisum sativum E-value=3e-73; Alpha-1,4-glucan-protein synthase [UDP-forming] 1 OS=Solanum tuberosum E-value=3e-70; UDP-arabinopyranose mutase 3 OS=Arabidopsis thaliana E-value=1e-69; Alpha-1,4-glucan-protein synthase [UDP-forming] 2 OS=Solanum tuberosum E-value=2e-68; Alpha-1,4-glucan-protein synthase [UDP-forming] OS=Zea mays E-value=4e-67; |
| Length | 581 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DSTEM2; |
| Sequence | CTCATCAACAACAACAACAATGGCTTCTTCATCCAAACCAACACCACCTTCTCAAAGATG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 820039 |
| Trichome-related Gene from Literature | 820039 |