Detail of EST/Unigene BE326005 |
Acc. | BE326005 |
Internal Acc. | NF083G08ST1F1065 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Linoleate 9S-lipoxygenase OS=Lens culinaris E-value=1e-80; Linoleate 9S-lipoxygenase-4 OS=Glycine max E-value=7e-72; Linoleate 9S-lipoxygenase (Fragment) OS=Phaseolus vulgaris E-value=2e-70; Seed linoleate 9S-lipoxygenase-3 OS=Glycine max E-value=2e-69; Seed linoleate 9S-lipoxygenase-3 OS=Pisum sativum E-value=4e-68; |
Length | 593 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSTEM2; |
Sequence | AAGCTACCTACCAATTTTCTTAGCAACGTTAGCCCAATACCATTGTTCACGGAACTTTTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K00461 arachidonate 5-lipoxygenase; Metabolism > Lipid Metabolism > ko00591 Linoleic acid metabolism > K00461 arachidonate 5-lipoxygenase; Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K08021 arachidonate 12-lipoxygenase (R-type) |
EC | 1.13.11.- 1.13.11.34 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 841944 |
Trichome-related Gene from Literature | 841944 |