Detail of EST/Unigene BE326122 |
Acc. | BE326122 |
Internal Acc. | NF086H02ST1F1025 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Dihydrodipicolinate synthase 2, chloroplastic OS=Arabidopsis thaliana E-value=5e-21; Dihydrodipicolinate synthase, chloroplastic OS=Nicotiana tabacum E-value=3e-19; Dihydrodipicolinate synthase 1, chloroplastic OS=Arabidopsis thaliana E-value=4e-19; Dihydrodipicolinate synthase, chloroplastic OS=Glycine max E-value=6e-19; Dihydrodipicolinate synthase 1, chloroplastic OS=Triticum aestivum E-value=2e-16; |
Length | 340 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSTEM2; |
Sequence | CAACAACACACTCTCAAAGCGACACCGTTTTCGTTCTTCTACTTCTAGGGTTTTGAGTTA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 819152 |
Trichome-related Gene from Literature | N/A |