Detail of EST/Unigene BE326180 |
Acc. | BE326180 |
Internal Acc. | NF086D09ST1F1075 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Cytochrome P450 98A2 OS=Glycine max E-value=1e-70; Cytochrome P450 98A3 OS=Arabidopsis thaliana E-value=8e-57; Cytochrome P450 98A1 OS=Sorghum bicolor E-value=2e-53; Cytochrome P450 83A1 OS=Arabidopsis thaliana E-value=2e-21; Cytochrome P450 750A1 OS=Pinus taeda E-value=2e-21; |
Length | 440 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSTEM2; |
Sequence | ACACAATTCATCACAATGGCTCTGTTTCTCACAATACCCCTTTCATTCATAGCCATTTTC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | ; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K07415 cytochrome P450, family 2, subfamily E; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07415 cytochrome P450, family 2, subfamily E; Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K07415 cytochrome P450, family 2, subfamily E; Metabolism > Lipid Metabolism > ko00591 Linoleic acid metabolism > K07415 cytochrome P450, family 2, subfamily E |
EC | 1.14.-.- 1.14.14.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 818686 |
Trichome-related Gene from Literature | N/A |