Detail of EST/Unigene BE326188 |
Acc. | BE326188 |
Internal Acc. | NF086E05ST1F1036 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase 2 OS=Arabidopsis thaliana E-value=1e-41; Glucan endo-1,3-beta-glucosidase 3 OS=Arabidopsis thaliana E-value=4e-38; Glucan endo-1,3-beta-glucosidase 4 OS=Arabidopsis thaliana E-value=4e-30; Glucan endo-1,3-beta-glucosidase 1 OS=Arabidopsis thaliana E-value=3e-29; Glucan endo-1,3-beta-glucosidase 7 OS=Arabidopsis thaliana E-value=7e-18; |
Length | 603 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSTEM2; |
Sequence | GTCTTATAACCCTCTCTCTCATTAATATTCTCCTACAGCTTTACCCCACTTTCATCACTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 842942 |
Trichome-related Gene from Literature | N/A |