| Detail of EST/Unigene BE354641 |
| Acc. | BE354641 |
| Internal Acc. | EST354731 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Naringenin,2-oxoglutarate 3-dioxygenase (Fragment) OS=Petunia hybrida E-value=5e-83; Naringenin,2-oxoglutarate 3-dioxygenase (Fragment) OS=Matthiola incana E-value=1e-77; Naringenin,2-oxoglutarate 3-dioxygenase OS=Arabidopsis thaliana E-value=5e-77; Flavanone 3-dioxygenase OS=Petroselinum crispum E-value=5e-76; Naringenin,2-oxoglutarate 3-dioxygenase OS=Malus domestica E-value=5e-76; |
| Length | 514 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SL_FLOWERBUDS3; |
| Sequence | GACACTAACAGCTTTAGCTTATGAAAAGACCCTTGAAACAAGTTTTATTATGGATGAAGA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 824287 |
| Trichome-related Gene from Literature | 824287 |