Detail of EST/Unigene BE433026 |
Acc. | BE433026 |
Internal Acc. | EST399555 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glutamate--cysteine ligase, chloroplastic OS=Solanum lycopersicum E-value=6e-49; Glutamate--cysteine ligase, chloroplastic OS=Nicotiana tabacum E-value=4e-46; Glutamate--cysteine ligase B, chloroplastic OS=Oryza sativa subsp. japonica E-value=8e-42; Glutamate--cysteine ligase B, chloroplastic OS=Oryza sativa subsp. indica E-value=8e-42; Glutamate--cysteine ligase A, chloroplastic OS=Oryza sativa subsp. indica E-value=8e-42; |
Length | 282 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SL_FRUIT; |
Sequence | TTTGCAAATTCACCTTTCACTGAAGGAAAACCTAATGGTTATCTCAGCAAGAGAAGCCAC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 828409 |
Trichome-related Gene from Literature | 828409 |