Detail of EST/Unigene BE435883 |
Acc. | BE435883 |
Internal Acc. | EST407057 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Linoleate 9S-lipoxygenase B OS=Solanum lycopersicum E-value=0; Probable linoleate 9S-lipoxygenase 5 OS=Solanum tuberosum E-value=4e-84; Linoleate 9S-lipoxygenase 6 (Fragment) OS=Solanum tuberosum E-value=4e-81; Probable linoleate 9S-lipoxygenase 4 OS=Solanum tuberosum E-value=4e-81; Linoleate 9S-lipoxygenase A OS=Solanum lycopersicum E-value=2e-80; |
Length | 548 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SL_FRUIT; |
Sequence | TGGCAGTTTGCCAAAGCCTATGTAGCAGTGAATGACATGGGCATTCATCAGCTGGATTAG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | ; Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K08021 arachidonate 12-lipoxygenase (R-type); Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K08022 arachidonate 15-lipoxygenase (second type) / 8-lipoxygenase (S-type) |
EC | 1.13.11.- 1.13.11.33 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 821808 |
Trichome-related Gene from Literature | N/A |