| Detail of EST/Unigene BE459166 |
| Acc. | BE459166 |
| Internal Acc. | EST414458 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Glutathione reductase, chloroplastic (Fragment) OS=Nicotiana tabacum E-value=1e-28; Glutathione reductase, chloroplastic/mitochondrial OS=Pisum sativum E-value=6e-17; Glutathione reductase, chloroplastic OS=Arabidopsis thaliana E-value=6e-16; Glutathione reductase, chloroplastic OS=Glycine max E-value=1e-15; Glutathione reductase, cytosolic OS=Pisum sativum E-value=9e-12; |
| Length | 349 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SL_GFRUIT; |
| Sequence | CTTTGAGCTCACCAAAGCTCAGTACAACTCTTTCTTCTCCAACTTTCCATTCTCTTTACC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 824631 |
| Trichome-related Gene from Literature | 824631 |