Detail of EST/Unigene BE460163 |
Acc. | BE460163 |
Internal Acc. | EST415455 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Aldehyde dehydrogenase OS=Craterostigma plantagineum E-value=3e-43; Aldehyde dehydrogenase family 3 member I1, chloroplastic OS=Arabidopsis thaliana E-value=3e-38; Aldehyde dehydrogenase family 3 member H1 OS=Arabidopsis thaliana E-value=6e-37; Probable aldehyde dehydrogenase ywdH OS=Bacillus subtilis (strain 168) E-value=3e-18; Aldehyde dehydrogenase family 3 member F1 OS=Arabidopsis thaliana E-value=1e-17; |
Length | 461 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SL_GFRUIT; |
Sequence | AATAATACGATATATCGCCGGCGAAGCACAGGCGACGAGCACAAAGTCGTCGACCTAATC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00903 Limonene and pinene degradation > K00128 aldehyde dehydrogenase (NAD+); Metabolism > Xenobiotics Biodegradation and Metabolism > ko00631 1,2-Dichloroethane degradation > K00128 aldehyde dehydrogenase (NAD+); Metabolism > Xenobiotics Biodegradation and Metabolism > ko00641 3-Chloroacrylic acid degradation > K00128 aldehyde dehydrogenase (NAD+); Metabolism > Carbohydrate Metabolism > ko00053 Ascorbate and aldarate metabolism > K00128 aldehyde dehydrogenase (NAD+); Metabolism > Carbohydrate Metabolism > ko00650 Butanoate metabolism > K00128 aldehyde dehydrogenase (NAD+); Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K00128 aldehyde dehydrogenase (NAD+); Metabolism > Carbohydrate Metabolism > ko00640 Propanoate metabolism > K00128 aldehyde dehydrogenase (NAD+); Metabolism > Carbohydrate Metabolism > ko00620 Pyruvate metabolism > K00128 aldehyde dehydrogenase (NAD+); Metabolism > Lipid Metab |
EC | 1.2.1.3 1.2.1.5 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 829573 |
Trichome-related Gene from Literature | 829573 |