Detail of EST/Unigene BE461011 |
Acc. | BE461011 |
Internal Acc. | EST412430 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Farnesyl pyrophosphate synthase 1 OS=Lupinus albus E-value=2e-57; Farnesyl pyrophosphate synthase 2 OS=Lupinus albus E-value=1e-55; Farnesyl pyrophosphate synthase OS=Helianthus annuus E-value=1e-55; Farnesyl diphosphate synthase 1 OS=Artemisia spiciformis E-value=2e-55; Farnesyl pyrophosphate synthase 2 OS=Parthenium argentatum E-value=1e-54; |
Length | 402 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SL_FRUIT; |
Sequence | CTCTGTCAAAAATGGCTGATCTGAAGAAGAAATTTTTGGATGTGTACTCTGTTCTTAAAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00900 Terpenoid biosynthesis > K00787 dimethylallyltranstransferase; Metabolism > Lipid Metabolism > ko00100 Biosynthesis of steroids > K00787 dimethylallyltranstransferase; Metabolism > Biosynthesis of Secondary Metabolites > ko00900 Terpenoid biosynthesis > K00795 geranyltranstransferase; Metabolism > Lipid Metabolism > ko00100 Biosynthesis of steroids > K00795 geranyltranstransferase |
EC | 2.5.1.1 2.5.1.10 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 827430 |
Trichome-related Gene from Literature | 827430 |