Detail of EST/Unigene BE461875 |
Acc. | BE461875 |
Internal Acc. | EST413390 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glutamate--cysteine ligase, chloroplastic OS=Solanum lycopersicum E-value=5e-82; Glutamate--cysteine ligase, chloroplastic OS=Nicotiana tabacum E-value=7e-81; Glutamate--cysteine ligase, chloroplastic OS=Arabidopsis thaliana E-value=2e-77; Glutamate--cysteine ligase, chloroplastic OS=Medicago truncatula E-value=3e-77; Glutamate--cysteine ligase, chloroplastic OS=Brassica juncea E-value=2e-76; |
Length | 456 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SL_FRUIT; |
Sequence | TGAAGTATGATCAAATTTCTGACTTGCTAAATGGTATTGCTGAACGGTGGGATTGGGAAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 828409 |
Trichome-related Gene from Literature | 828409 |