Detail of EST/Unigene BE462870 |
Acc. | BE462870 |
Internal Acc. | EST325256 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 1B, chloroplastic OS=Solanum lycopersicum E-value=5e-18; Chlorophyll a-b binding protein 21, chloroplastic OS=Nicotiana tabacum E-value=2e-16; Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=7e-15; Chlorophyll a-b binding protein 1, chloroplastic OS=Sinapis alba E-value=3e-14; Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=6e-14; |
Length | 266 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SL_flowerbuds4; |
Sequence | CTTCAACAATATGGGATACCATGAAATACTCAACACTCCTCTCTTAATATAAATCATGGC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 818006 |
Trichome-related Gene from Literature | N/A |