Detail of EST/Unigene BE940967 |
Acc. | BE940967 |
Internal Acc. | EST420546 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Alpha-1,4-glucan-protein synthase [UDP-forming] OS=Pisum sativum E-value=7e-54; Alpha-1,4-glucan-protein synthase [UDP-forming] 2 OS=Solanum tuberosum E-value=2e-47; Alpha-1,4-glucan-protein synthase [UDP-forming] OS=Zea mays E-value=9e-46; Alpha-1,4-glucan-protein synthase [UDP-forming] 1 OS=Solanum tuberosum E-value=1e-44; UDP-arabinopyranose mutase 1 OS=Oryza sativa subsp. japonica E-value=1e-44; |
Length | 494 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_MGHG; |
Sequence | ATAAATGTTATCCGCGACCATTTGGGGGGGGGAGTGAGGACTGGACTTCCATACATTTGG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 820039 |
Trichome-related Gene from Literature | 820039 |