Detail of EST/Unigene BE941263
Acc. BE941263
Internal Acc. EST420842
Type EST
Annotation (Top 5 hits in Uniprot_trembl) 60S ribosomal protein L32-1 OS=Arabidopsis thaliana E-value=9e-10; 60S ribosomal protein L32-2 OS=Arabidopsis thaliana E-value=1e-09; 60S ribosomal protein L32 OS=Tetrahymena thermophila (strain SB210) E-value=3e-07; 60S ribosomal protein L32 OS=Ictalurus punctatus E-value=1e-06; 60S ribosomal protein L32 OS=Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987) E-value=3e-06;
Length 102 nt
Species Medicago truncatula
Belonged EST Libraries MT_MGHG;
Sequence CAAATGGTTTTAAGAAATTTGTTGTTTGCAATGTTAATGATTTGGAGCTTTTAATGATGC
ACAATAGGACTTATTGTGCTGAGATTGCGCACAATGTGTTCA
EST members of Unigene N/A
InterProScan Domain  
Gene Ontology  
KEGG Orthology Genetic Information Processing > Translation > ko03010 Ribosome > K02912 large subunit ribosomal protein L32e
EC
Transcription Factor Family
Transporter Classification Family
Probeset
Corresponding NCBI Gene 827535 
Trichome-related Gene from Literature N/A