Detail of EST/Unigene BE942490 |
Acc. | BE942490 |
Internal Acc. | EST422069 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Acetate/butyrate--CoA ligase AAE7, peroxisomal OS=Arabidopsis thaliana E-value=2e-34; Probable acyl-activating enzyme 2 OS=Arabidopsis thaliana E-value=1e-21; Probable acyl-activating enzyme 1, peroxisomal OS=Arabidopsis thaliana E-value=1e-18; Probable acyl-activating enzyme 5, peroxisomal OS=Arabidopsis thaliana E-value=5e-18; Probable acyl-activating enzyme 8 OS=Arabidopsis thaliana E-value=1e-17; |
Length | 494 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_MGHG; |
Sequence | GCTATACTTGAGACATCAGTGGTCGCTAGACCAGACGAGAAATGGGGCGAGTCTCCGTGT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K01895 acetyl-CoA synthetase; Metabolism > Carbohydrate Metabolism > ko00640 Propanoate metabolism > K01895 acetyl-CoA synthetase; Metabolism > Carbohydrate Metabolism > ko00620 Pyruvate metabolism > K01895 acetyl-CoA synthetase; Metabolism > Energy Metabolism > ko00720 Reductive carboxylate cycle (CO2 fixation) > K01895 acetyl-CoA synthetase; Metabolism > Carbohydrate Metabolism > ko00650 Butanoate metabolism > K01896 medium-chain acyl-CoA synthetase |
EC | 6.2.1.1 6.2.1.2 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 820946 |
Trichome-related Gene from Literature | N/A |