| Detail of EST/Unigene BE942912 |
| Acc. | BE942912 |
| Internal Acc. | EST422491 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Acyl-coenzyme A oxidase 4, peroxisomal OS=Arabidopsis thaliana E-value=4e-37; Acyl-CoA dehydrogenase, short-chain specific OS=Clostridium acetobutylicum (strain ATCC 824 / DSM 792 / JCM 1419 / LMG 5710 / VKM B-1787) E-value=7e-07; Probable glutaryl-CoA dehydrogenase, mitochondrial OS=Caenorhabditis elegans E-value=2e-06; |
| Length | 260 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_MGHG; |
| Sequence | GGAGGCACCTGGGTGAACTGTCACAAAAATAGAAAATAAAATTGGACTTAGAATCGTACA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00632 Benzoate degradation via CoA ligation > K00252 glutaryl-CoA dehydrogenase; Metabolism > Lipid Metabolism > ko00071 Fatty acid metabolism > K00252 glutaryl-CoA dehydrogenase; Metabolism > Amino Acid Metabolism > ko00310 Lysine degradation > K00252 glutaryl-CoA dehydrogenase; Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K00252 glutaryl-CoA dehydrogenase |
| EC | 1.3.99.7 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 824347 |
| Trichome-related Gene from Literature | N/A |