Detail of EST/Unigene BE943101 |
Acc. | BE943101 |
Internal Acc. | EST422680 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Fructose-1,6-bisphosphatase, cytosolic OS=Arabidopsis thaliana E-value=1e-26; Fructose-1,6-bisphosphatase, cytosolic OS=Musa acuminata E-value=2e-25; Fructose-1,6-bisphosphatase, cytosolic OS=Beta vulgaris E-value=2e-25; Fructose-1,6-bisphosphatase, cytosolic OS=Solanum tuberosum E-value=6e-25; Fructose-1,6-bisphosphatase, cytosolic OS=Spinacia oleracea E-value=2e-24; |
Length | 400 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_MGHG; |
Sequence | TATGGATCTCCAAGCAGATTCTAACAGAACTGGGTTGATGACGGTAACAAGGTTTGTTCT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00051 Fructose and mannose metabolism > K03841 fructose-1,6-bisphosphatase I; Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K03841 fructose-1,6-bisphosphatase I; Metabolism > Carbohydrate Metabolism > ko00030 Pentose phosphate pathway > K03841 fructose-1,6-bisphosphatase I; Metabolism > Energy Metabolism > ko00710 Carbon fixation in photosynthetic organisms > K03841 fructose-1,6-bisphosphatase I |
EC | 3.1.3.11 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 840953 |
Trichome-related Gene from Literature | N/A |