Detail of EST/Unigene BE943269 |
Acc. | BE943269 |
Internal Acc. | EST422848 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Alternative oxidase 2, mitochondrial OS=Glycine max E-value=0; Alternative oxidase, mitochondrial OS=Mangifera indica 1 E-value=1e-97; Alternative oxidase 2, mitochondrial OS=Arabidopsis thaliana E-value=5e-94; Alternative oxidase 3, mitochondrial OS=Glycine max E-value=6e-91; Alternative oxidase 2, mitochondrial OS=Nicotiana tabacum E-value=9e-90; |
Length | 602 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_MGHG; |
Sequence | CCACTGATGTGTTTTTTAAGAGACGTTATGGTTGCCGTGCAATGATGCTTGAAACAGTTG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 836542 |
Trichome-related Gene from Literature | 836542 |