Detail of EST/Unigene BE943415 |
Acc. | BE943415 |
Internal Acc. | EST422994 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 50S ribosomal protein L16, chloroplastic OS=Glycine max E-value=6e-51; 50S ribosomal protein L16, chloroplastic OS=Cicer arietinum E-value=1e-50; 50S ribosomal protein L16, chloroplastic (Fragment) OS=Vigna unguiculata E-value=2e-50; 50S ribosomal protein L16, chloroplastic OS=Phaseolus angularis E-value=3e-50; 50S ribosomal protein L16, chloroplastic OS=Eucalyptus globulus subsp. globulus E-value=3e-50; |
Length | 466 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_MGHG; |
Sequence | ATTCCGTAAATCACATCGAGTGTAGAATGAAAGGAAAAGCCTATGGAGGTAATACAATTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |