Detail of EST/Unigene BF051593 |
Acc. | BF051593 |
Internal Acc. | EST436798 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Cytochrome P450 71B22 OS=Arabidopsis thaliana E-value=9e-32; Cytochrome P450 71A9 OS=Glycine max E-value=3e-31; Cytochrome P450 71B5 OS=Arabidopsis thaliana E-value=6e-31; Cytochrome P450 71B38 OS=Arabidopsis thaliana E-value=2e-30; Cytochrome P450 71B14 OS=Arabidopsis thaliana E-value=2e-30; |
Length | 530 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SL_GFRUIT; |
Sequence | CCCTTGGGTTTTCATAGTGTTTGGCTCATGGCTATTTGCATTAGCTGTTGTCTTTAAAAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00232 Caffeine metabolism > K07409 cytochrome P450, family 1, subfamily A, polypeptide 2; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K07409 cytochrome P450, family 1, subfamily A, polypeptide 2; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07409 cytochrome P450, family 1, subfamily A, polypeptide 2; Metabolism > Lipid Metabolism > ko00591 Linoleic acid metabolism > K07409 cytochrome P450, family 1, subfamily A, polypeptide 2; Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K07409 cytochrome P450, family 1, subfamily A, polypeptide 2; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07409 cytochrome P450, family 1, subfamily A, polypeptide 2; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07 |
EC | 1.14.14.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 822221 |
Trichome-related Gene from Literature | N/A |