Detail of EST/Unigene BF051950 |
Acc. | BF051950 |
Internal Acc. | EST437116 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Rac-like GTP-binding protein ARAC6 OS=Arabidopsis thaliana E-value=2e-42; Rac-like GTP-binding protein RHO1 OS=Beta vulgaris E-value=2e-42; Rac-like GTP-binding protein ARAC1 OS=Arabidopsis thaliana E-value=2e-42; Rac-like GTP-binding protein RHO1 OS=Pisum sativum E-value=4e-42; Rac-like GTP-binding protein ARAC11 OS=Arabidopsis thaliana E-value=5e-42; |
Length | 564 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SL_GFRUIT; |
Sequence | TGTGAAGAACGGTTCAACGGCATAATTTTGCGGCTAAAAAATGCGAGCCATAATATAATG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K04392 Ras-related C3 botulinum toxin substrate 1; Environmental Information Processing > Signal Transduction > ko04370 VEGF signaling pathway > K04392 Ras-related C3 botulinum toxin substrate 1; Environmental Information Processing > Signal Transduction > ko04310 Wnt signaling pathway > K04392 Ras-related C3 botulinum toxin substrate 1 |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 829750 |
Trichome-related Gene from Literature | N/A |