| Detail of EST/Unigene BF631751 |
| Acc. | BF631751 |
| Internal Acc. | NF008D10DT1F1079 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | ATP synthase delta chain, chloroplastic OS=Pisum sativum E-value=2e-51; ATP synthase delta chain, chloroplastic OS=Nicotiana tabacum E-value=1e-34; ATP synthase delta chain, chloroplastic OS=Spinacia oleracea E-value=2e-24; ATP synthase delta chain, chloroplastic OS=Sorghum bicolor E-value=3e-20; ATP synthase delta chain, chloroplastic OS=Chlamydomonas reinhardtii E-value=4e-11; |
| Length | 585 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_Drought; |
| Sequence | ATTTCTTCTTCATCTACCAACGCCAACAATGGCGTCTCTACAACACACCACAGCTTCAAT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | 3.6.3.14 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 826551 |
| Trichome-related Gene from Literature | N/A |