Detail of EST/Unigene BF631886 |
Acc. | BF631886 |
Internal Acc. | NF007F10DT1F1080 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 29 kDa ribonucleoprotein B, chloroplastic OS=Nicotiana sylvestris E-value=6e-15; 31 kDa ribonucleoprotein, chloroplastic OS=Nicotiana plumbaginifolia E-value=2e-14; 28 kDa ribonucleoprotein, chloroplastic OS=Spinacia oleracea E-value=2e-14; Ribonucleoprotein At2g37220, chloroplastic OS=Arabidopsis thaliana E-value=7e-14; 29 kDa ribonucleoprotein A, chloroplastic OS=Nicotiana sylvestris E-value=2e-13; |
Length | 625 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_Drought; |
Sequence | CATTGTTTTCATCTTCCATCAACACTGTCAAATGTCTACGTTCCAAAAACTCCTCATTAG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 842294 |
Trichome-related Gene from Literature | N/A |