| Detail of EST/Unigene BF632009 |
| Acc. | BF632009 |
| Internal Acc. | NF033F05DT1F1044 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | NifU-like protein 4, mitochondrial OS=Arabidopsis thaliana E-value=4e-20; NifU-like protein 5, mitochondrial OS=Arabidopsis thaliana E-value=8e-20; NFU1 iron-sulfur cluster scaffold homolog, mitochondrial OS=Drosophila virilis E-value=2e-14; NFU1 iron-sulfur cluster scaffold homolog, mitochondrial OS=Drosophila ananassae E-value=2e-14; NFU1 iron-sulfur cluster scaffold homolog, mitochondrial OS=Drosophila yakuba E-value=3e-14; |
| Length | 207 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_Drought; |
| Sequence | CAAGCTGCCGCTTCCAAAGACACAGCAATTCACAGATGATGATTCTGAAACAGTTGCTGA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 841563 |
| Trichome-related Gene from Literature | N/A |