Detail of EST/Unigene BF632083 |
Acc. | BF632083 |
Internal Acc. | NF016E03DT1F1020 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Photosystem II reaction center W protein, chloroplastic OS=Spinacia oleracea E-value=2e-10; Photosystem II reaction center W protein, chloroplastic OS=Arabidopsis thaliana E-value=6e-09; Photosystem II reaction center W protein, chloroplastic OS=Oryza sativa subsp. japonica E-value=2e-07; |
Length | 212 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_Drought; |
Sequence | CAGCCATGTCAAGCCCAGCAGCCATGGCATTGGTGGATGAAAGAATGAGTACTGAAGGAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 817606 |
Trichome-related Gene from Literature | N/A |