| Detail of EST/Unigene BF632379 |
| Acc. | BF632379 |
| Internal Acc. | NF033C09DT1F1067 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Acyl carrier protein 4, chloroplastic OS=Arabidopsis thaliana E-value=5e-07; Acyl carrier protein SF2, chloroplastic OS=Brassica campestris E-value=9e-07; Acyl carrier protein, chloroplastic OS=Brassica napus E-value=2e-06; Acyl carrier protein, chloroplastic OS=Brassica napus E-value=3e-06; |
| Length | 310 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_Drought; |
| Sequence | TACTATTCTATCTTCTTCCTAAGCTTCAATACAATGGCCTCTCTTTCAGCCACCTCTCTT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 828608 |
| Trichome-related Gene from Literature | N/A |