Detail of EST/Unigene BF632532 |
Acc. | BF632532 |
Internal Acc. | NF028A05DT1F1034 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Uncharacterized oxidoreductase ybiC OS=Escherichia coli (strain K12) E-value=1e-81; Uncharacterized oxidoreductase ybiC OS=Escherichia coli O157:H7 E-value=1e-80; L-lactate dehydrogenase OS=Cupriavidus necator (strain ATCC 17699 / H16 / DSM 428 / Stanier 337) E-value=2e-16; L-sulfolactate dehydrogenase OS=Methanothermobacter thermautotrophicus (strain ATCC 29096 / DSM 1053 / JCM 10044 / NBRC 100330 / Delta H) E-value=7e-13; L-sulfolactate dehydrogenase OS=Methanocaldococcus jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM 10045 / NBRC 100440) E-value=3e-12; |
Length | 434 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_Drought; |
Sequence | TGCTTCTGCCGTTCGCGACGCGTGTTCACTTCCCACTCGCCCGGTAGCAAAATCGGCTTA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00020 Citrate cycle (TCA cycle) > K00025 malate dehydrogenase; Metabolism > Carbohydrate Metabolism > ko00630 Glyoxylate and dicarboxylate metabolism > K00025 malate dehydrogenase; Metabolism > Carbohydrate Metabolism > ko00620 Pyruvate metabolism > K00025 malate dehydrogenase; Metabolism > Energy Metabolism > ko00710 Carbon fixation in photosynthetic organisms > K00025 malate dehydrogenase; Metabolism > Energy Metabolism > ko00720 Reductive carboxylate cycle (CO2 fixation) > K00025 malate dehydrogenase |
EC | 1.-.-.- 1.1.1.37 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |