Detail of EST/Unigene BF632689 |
Acc. | BF632689 |
Internal Acc. | NF044C09DT1F1070 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Serine/threonine-protein kinase AtPK2/AtPK19 OS=Arabidopsis thaliana E-value=4e-46; Serine/threonine-protein kinase AtPK1/AtPK6 OS=Arabidopsis thaliana E-value=5e-45; Protein kinase 2 OS=Dictyostelium discoideum E-value=3e-35; RAC family serine/threonine-protein kinase homolog OS=Dictyostelium discoideum E-value=1e-31; Ribosomal protein S6 kinase beta-2 OS=Homo sapiens E-value=4e-29; |
Length | 565 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_Drought; |
Sequence | CCAGCCCACAAGTCATACACAGTAGGTCCCACTCCTTCGTCGGTCCCTCCCCTCGCTTCC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04012 ErbB signaling pathway > K04688 p70 ribosomal S6 kinase; Environmental Information Processing > Signal Transduction > ko04150 mTOR signaling pathway > K04688 p70 ribosomal S6 kinase; Environmental Information Processing > Signal Transduction > ko04350 TGF-beta signaling pathway > K04688 p70 ribosomal S6 kinase |
EC | 2.7.11.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 820019 |
Trichome-related Gene from Literature | N/A |