Detail of EST/Unigene BF632716 |
Acc. | BF632716 |
Internal Acc. | NF045F04DT1F1043 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Mannan endo-1,4-beta-mannosidase 2 OS=Arabidopsis thaliana E-value=6e-38; Mannan endo-1,4-beta-mannosidase 5 OS=Arabidopsis thaliana E-value=3e-33; Mannan endo-1,4-beta-mannosidase 2 OS=Oryza sativa subsp. japonica E-value=7e-31; Putative mannan endo-1,4-beta-mannosidase 5 OS=Oryza sativa subsp. japonica E-value=3e-23; Mannan endo-1,4-beta-mannosidase 6 OS=Arabidopsis thaliana E-value=8e-22; |
Length | 592 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_Drought; |
Sequence | CTCTTTCAGAAGAGAGATCTATACATTCTGATCATTTGGGGTGTGAAGAGCAAACACATT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 816596 |
Trichome-related Gene from Literature | N/A |