Detail of EST/Unigene BF632848 |
Acc. | BF632848 |
Internal Acc. | NF045H08DT1F1076 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Beta-glucosidase 15 OS=Arabidopsis thaliana E-value=8e-16; Beta-glucosidase 13 OS=Arabidopsis thaliana E-value=1e-15; Beta-glucosidase 14 OS=Arabidopsis thaliana E-value=2e-15; Beta-glucosidase 29 OS=Oryza sativa subsp. japonica E-value=3e-15; Beta-glucosidase 12 OS=Oryza sativa subsp. japonica E-value=4e-15; |
Length | 603 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_Drought; |
Sequence | GTCATTTTTCTATCAACTTCCAAAGTTTTCTTAGATGGAGAAAATGGAGATTCTGTCATC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00940 Phenylpropanoid biosynthesis > K05350 beta-glucosidase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K05350 beta-glucosidase; Metabolism > Metabolism of Other Amino Acids > ko00460 Cyanoamino acid metabolism > K05350 beta-glucosidase |
EC | 3.2.1.21 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 819052 |
Trichome-related Gene from Literature | N/A |