Detail of EST/Unigene BF633012 |
Acc. | BF633012 |
Internal Acc. | NF051D04DT1F1042 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glutathione S-transferase F12 OS=Arabidopsis thaliana E-value=4e-39; Glutathione S-transferase F11 OS=Arabidopsis thaliana E-value=2e-38; Glutathione S-transferase F9 OS=Arabidopsis thaliana E-value=3e-28; Glutathione S-transferase F10 OS=Arabidopsis thaliana E-value=7e-28; Glutathione S-transferase APIC OS=Nicotiana tabacum E-value=3e-22; |
Length | 382 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_Drought; |
Sequence | CAACATTATAATTATCATCACTGAGATTTTAGGGTATTTTCAAGTAATTAAAGAGCAGGG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00799 glutathione S-transferase |
EC | 2.5.1.18 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 831586 |
Trichome-related Gene from Literature | 831586 |