| Detail of EST/Unigene BF633450 |
| Acc. | BF633450 |
| Internal Acc. | NF052E01DT1F1004 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Serine hydroxymethyltransferase, mitochondrial OS=Pisum sativum E-value=8e-24; Serine hydroxymethyltransferase, mitochondrial OS=Arabidopsis thaliana E-value=2e-23; Serine hydroxymethyltransferase 1, mitochondrial OS=Flaveria pringlei E-value=6e-23; Serine hydroxymethyltransferase, mitochondrial OS=Solanum tuberosum E-value=2e-22; Serine hydroxymethyltransferase 2, mitochondrial OS=Flaveria pringlei E-value=1e-21; |
| Length | 573 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_Drought; |
| Sequence | CAGAATGGGAACTCCTGCTCTTACATCTAGGGGTTTTGTTGAGGATGATTTTAAAAAAGT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | 2.1.2.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 829949 |
| Trichome-related Gene from Literature | 829949 |