Detail of EST/Unigene BF633450 |
Acc. | BF633450 |
Internal Acc. | NF052E01DT1F1004 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Serine hydroxymethyltransferase, mitochondrial OS=Pisum sativum E-value=8e-24; Serine hydroxymethyltransferase, mitochondrial OS=Arabidopsis thaliana E-value=2e-23; Serine hydroxymethyltransferase 1, mitochondrial OS=Flaveria pringlei E-value=6e-23; Serine hydroxymethyltransferase, mitochondrial OS=Solanum tuberosum E-value=2e-22; Serine hydroxymethyltransferase 2, mitochondrial OS=Flaveria pringlei E-value=1e-21; |
Length | 573 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_Drought; |
Sequence | CAGAATGGGAACTCCTGCTCTTACATCTAGGGGTTTTGTTGAGGATGATTTTAAAAAAGT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 2.1.2.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 829949 |
Trichome-related Gene from Literature | 829949 |