| Detail of EST/Unigene BF633850 |
| Acc. | BF633850 |
| Internal Acc. | NF065A04DT1F1033 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Plastocyanin, chloroplastic OS=Pisum sativum E-value=3e-62; Plastocyanin, chloroplastic OS=Solanum lycopersicum E-value=1e-48; Plastocyanin, chloroplastic OS=Silene pratensis E-value=6e-48; Plastocyanin, chloroplastic OS=Spinacia oleracea E-value=3e-47; Plastocyanin A, chloroplastic OS=Populus nigra E-value=2e-46; |
| Length | 502 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_Drought; |
| Sequence | TCTTGAGAGAAAATGGCCACCGTTACTTCCACCACCGTTGCTATTCCATCATTCACAGGC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 838622 |
| Trichome-related Gene from Literature | N/A |