Detail of EST/Unigene BF634127 |
Acc. | BF634127 |
Internal Acc. | NF084F10DT1F1090 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Allene oxide cyclase 4, chloroplastic OS=Arabidopsis thaliana E-value=2e-48; Allene oxide cyclase 3, chloroplastic OS=Arabidopsis thaliana E-value=5e-48; Allene oxide cyclase 2, chloroplastic OS=Arabidopsis thaliana E-value=6e-45; Allene oxide cyclase 1, chloroplastic OS=Arabidopsis thaliana E-value=7e-44; |
Length | 645 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_Drought; |
Sequence | CTTCATTCATCATCATCACCTTCAATGGCATCCATGAGTTCTTTGAAAATGATTTCTTCC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 837888 |
Trichome-related Gene from Literature | N/A |