| Detail of EST/Unigene BF634128 |
| Acc. | BF634128 |
| Internal Acc. | NF082F04DT1F1042 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Geraniol 8-hydroxylase OS=Catharanthus roseus E-value=3e-14; 7-ethoxycoumarin O-deethylase OS=Helianthus tuberosus E-value=6e-14; Cytochrome P450 71A8 OS=Mentha piperita E-value=1e-13; Cytochrome P450 71B12 OS=Arabidopsis thaliana E-value=2e-13; Geraniol 8-hydroxylase OS=Swertia mussotii E-value=2e-13; |
| Length | 293 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_Drought; |
| Sequence | GTTCAATAGCTCATAGTTCTCTCAAAAAAATGGACTTGTTACAAAGTTCCACACTTTCCT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K07413 cytochrome P450, family 2, subfamily C; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07413 cytochrome P450, family 2, subfamily C; Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K07413 cytochrome P450, family 2, subfamily C; Metabolism > Lipid Metabolism > ko00591 Linoleic acid metabolism > K07413 cytochrome P450, family 2, subfamily C; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07413 cytochrome P450, family 2, subfamily C |
| EC | 1.14.14.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 832584 |
| Trichome-related Gene from Literature | N/A |