| Detail of EST/Unigene BF634382 |
| Acc. | BF634382 |
| Internal Acc. | NF087C11DT1F1085 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Mitogen-activated protein kinase 16 OS=Arabidopsis thaliana E-value=6e-88; Mitogen-activated protein kinase 14 OS=Oryza sativa subsp. japonica E-value=3e-87; Mitogen-activated protein kinase 15 OS=Oryza sativa subsp. japonica E-value=5e-87; Mitogen-activated protein kinase 9 OS=Oryza sativa subsp. japonica E-value=5e-86; Mitogen-activated protein kinase 8 OS=Arabidopsis thaliana E-value=7e-85; |
| Length | 526 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_Drought; |
| Sequence | CACAGCAAATGTTTTTCACCGAGATTTAAAGCCGAAAAACATTTTGGCGAATGCTGACTG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04012 ErbB signaling pathway > K04371 extracellular signal-regulated kinase 1/2; Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K04371 extracellular signal-regulated kinase 1/2; Environmental Information Processing > Signal Transduction > ko04150 mTOR signaling pathway > K04371 extracellular signal-regulated kinase 1/2; Environmental Information Processing > Signal Transduction > ko04350 TGF-beta signaling pathway > K04371 extracellular signal-regulated kinase 1/2; Environmental Information Processing > Signal Transduction > ko04370 VEGF signaling pathway > K04371 extracellular signal-regulated kinase 1/2 |
| EC | 2.7.11.- 2.7.11.24 |
| Transcription Factor Family | WRKY |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 832019 |
| Trichome-related Gene from Literature | N/A |