Detail of EST/Unigene BF634691 |
Acc. | BF634691 |
Internal Acc. | NF069B06DT1F1048 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | NifU-like protein 4, mitochondrial OS=Arabidopsis thaliana E-value=7e-39; NifU-like protein 5, mitochondrial OS=Arabidopsis thaliana E-value=4e-37; NFU1 iron-sulfur cluster scaffold homolog, mitochondrial OS=Drosophila melanogaster E-value=1e-24; NFU1 iron-sulfur cluster scaffold homolog, mitochondrial OS=Mus musculus E-value=5e-24; NFU1 iron-sulfur cluster scaffold homolog, mitochondrial OS=Homo sapiens E-value=5e-24; |
Length | 678 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_Drought; |
Sequence | GTTACAATCCGCATCGAAGAACCCTAATTCCTTCGACGATTCCTTCTACAATCGAAGATT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 821647 |
Trichome-related Gene from Literature | N/A |