Detail of EST/Unigene BF634704 |
Acc. | BF634704 |
Internal Acc. | NF069E03DT1F1022 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Elongation factor G, mitochondrial OS=Arabidopsis thaliana E-value=4e-32; Elongation factor G, mitochondrial OS=Oryza sativa subsp. japonica E-value=3e-30; Elongation factor G, mitochondrial OS=Dictyostelium discoideum E-value=8e-17; Elongation factor G 1 OS=Desulfotalea psychrophila (strain LSv54 / DSM 12343) E-value=8e-17; Elongation factor G, mitochondrial OS=Rattus norvegicus E-value=7e-16; |
Length | 610 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_Drought; |
Sequence | AATAAAAAAAATGATTTTCTAGTTTCTAAAGAAACCAGACCAAGTGATTCCTGAGATTAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 3.6.5.3 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 819110 |
Trichome-related Gene from Literature | N/A |