Detail of EST/Unigene BF634883 |
Acc. | BF634883 |
Internal Acc. | NF075H08DT1F1075 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Alcohol dehydrogenase-like 3 OS=Arabidopsis thaliana E-value=9e-38; Alcohol dehydrogenase-like 4 OS=Arabidopsis thaliana E-value=2e-30; S-(hydroxymethyl)glutathione dehydrogenase OS=Haemophilus influenzae (strain ATCC 51907 / DSM 11121 / KW20 / Rd) E-value=2e-21; S-(hydroxymethyl)glutathione dehydrogenase OS=Shigella sonnei (strain Ss046) E-value=3e-21; S-(hydroxymethyl)glutathione dehydrogenase OS=Escherichia coli (strain UTI89 / UPEC) E-value=3e-21; |
Length | 696 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_Drought; |
Sequence | CTATAGTTTTGAATGTACCGGAAATTTGAACGTTCTAAGAGATAGCTTCTTATCTGTTCA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00624 1- and 2-Methylnaphthalene degradation > K00001 alcohol dehydrogenase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00641 3-Chloroacrylic acid degradation > K00001 alcohol dehydrogenase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00001 alcohol dehydrogenase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00001 alcohol dehydrogenase; Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K00001 alcohol dehydrogenase; Metabolism > Lipid Metabolism > ko00120 Bile acid biosynthesis > K00001 alcohol dehydrogenase; Metabolism > Lipid Metabolism > ko00071 Fatty acid metabolism > K00001 alcohol dehydrogenase; Metabolism > Amino Acid Metabolism > ko00350 Tyrosine metabolism > K00001 alcohol dehydrogenase; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 |
EC | 1.1.1.1 1.1.1.284 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 840172 |
Trichome-related Gene from Literature | N/A |