Detail of EST/Unigene BF634926 |
Acc. | BF634926 |
Internal Acc. | NF077C06DT1F1049 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Beta-ureidopropionase OS=Rattus norvegicus E-value=8e-38; Beta-ureidopropionase OS=Pongo abelii E-value=8e-38; Beta-ureidopropionase OS=Homo sapiens E-value=8e-38; Beta-ureidopropionase OS=Dictyostelium discoideum E-value=1e-37; Beta-ureidopropionase OS=Mus musculus E-value=3e-37; |
Length | 672 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_Drought; |
Sequence | CTTCCAAACAGTCTCAAAACGGAGATGGACAAGTCCGAAAATAGAGCAGAGAATGAACAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00983 Drug metabolism - other enzymes > K01431 beta-ureidopropionase; Metabolism > Nucleotide Metabolism > ko00240 Pyrimidine metabolism > K01431 beta-ureidopropionase; Metabolism > Metabolism of Other Amino Acids > ko00410 beta-Alanine metabolism > K01431 beta-ureidopropionase; Metabolism > Metabolism of Cofactors and Vitamins > ko00770 Pantothenate and CoA biosynthesis > K01431 beta-ureidopropionase |
EC | 3.5.1.6 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 836558 |
Trichome-related Gene from Literature | N/A |