Detail of EST/Unigene BF634940 |
Acc. | BF634940 |
Internal Acc. | NF076G06DT1F1051 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Triosephosphate isomerase, chloroplastic OS=Arabidopsis thaliana E-value=5e-61; Triosephosphate isomerase, chloroplastic OS=Fragaria ananassa E-value=1e-59; Triosephosphate isomerase, chloroplastic OS=Spinacia oleracea E-value=2e-58; Triosephosphate isomerase, chloroplastic OS=Secale cereale E-value=3e-51; Triosephosphate isomerase, cytosolic OS=Stellaria longipes E-value=1e-29; |
Length | 594 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_Drought; |
Sequence | CTGATCCAGAACTCGTTACTTCCAACCCACAAGCTTCCAACTTCCAACAATCATCCATGG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00051 Fructose and mannose metabolism > K01803 triosephosphate isomerase (TIM); Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K01803 triosephosphate isomerase (TIM); Metabolism > Carbohydrate Metabolism > ko00031 Inositol metabolism > K01803 triosephosphate isomerase (TIM); Metabolism > Energy Metabolism > ko00710 Carbon fixation in photosynthetic organisms > K01803 triosephosphate isomerase (TIM) |
EC | 5.3.1.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 816652 |
Trichome-related Gene from Literature | N/A |